ADVANCED CERTIFICATE OF SECONDARY SCHOOL EDUCATION
HOLIDAY FORM SIX PACKAGE JUNE 2026
- a. Why are there more color-blind individuals than hemophiliacs in the population when the alleles for both defects are inherited in the same fashion that is sex-linked?
b. If a pure stain of mice with brown-colored fur are allowed to breed with a pure stain of a mice with gray-colored fur they produce offspring having brown-colored fur. If the F1 mice are allowed to interbreed they produce an F2 generation with fur color in the proportion of three brown-colored to one gray. Carry out genetic crosses to illustrate these results. - a. The biologists, Mathias Schleiden and Theodor Schwann cooperatively worked on the cell structure and developed cell theory. But morden Cytologists they rejected their ideas. In one point per each scientist Justify the validity of the statement
b. In Biuret test, the solutions containing proteins form a purple color with a dilute 1% copper (II) sulphate and sodium hydroxide solution. In this test, explain the importance of the following:
i. Dillute 1% copper (II) sulphate
ii. Sodium hydroxide solution
iii. Purple color - In one of the best students of the country, a form six student failed to construct an indented dichotomous key for identification of arthropods. As a pre-university student, what procedures would you suggest to this student
- a. Charles Darwin once said “it is not the strongest of the species that survive, nor the most intelligent, but the one most responsive to change.” Explain what he meant
b. Most mosquitos now found to be DDT resistant although DDT was supposed to be highly effective insecticide in the past. By using knowledge of organic evolution, explain this statement
c. Account for the following statements as used in organic evolution
i. Frogs have fish-like tad-pole in its life history
ii. Forelimbs of all vertebrates are basically the similar
iii. Animals have some non-functional organs
iv. The organisms that exist today do so because their ancestors had traits that allowed them and their offsprings to thrive
v. Individuals do not evolve, but population do so - In some plant species during condition D, compound K combines with oxygen under the influence of enzyme M to form compound N and 3-PGA, then compound N undergoes a series of reactions involving three different organelles to form 3-PGA.
i. Give the name of condition D
ii. Give the name of enzyme M
iii. Give the names of compound K and N
iv. With one reason specify which plant species is condition K likely to take place
v. Name three organelles involved in the conversion of compound N to PGA - a. Biologically any group of organism of the same species living in given area is termed as population but any population tend to increase in number of the organisms that called population growth. Basing on the help of growth curve Explain the following.
i. J-shaped growth curve.
ii. S-shaped growth curve.
b. i. In ecology, we can record the mass of a living materials at particular time in the trophic level. Briefly explain the pyramid of Biomass as used in ecology.
ii. Write down any four short falls related to pyramid of biomass. - a. Mr Njige discovers a new species of frog in the Amazon forest. He wants to name the species following the rules of binomial nomenclature. How should they name the hybrid species following the rules of binomial nomenclature? Use six points
b. With examples, briefly explain why some organisms are difficult to classify and whether the taxonomists will ever reach a stopping point in their study of classification. Use 3
c. Give the phylum, class, order, genus and species to which you belong. - a. Organism of the same species living in the same habitat may fail to pass their genes to new generation as results of reproduction isolation. Which lead to organic evolution that may occur in two mechanism of reproduction isolation as pre zygotic and post zygotic mechanism. Clearly explain the concept of these two mechanism of reproduction isolation and the three mechanism which occurs in post zygotic mechanism which results to reproduction isolation to support organic evolution.
b. If a farmer wants to get a quality products with high yield from animals and plants crops as a form six students with knowledge of methods of selective breeding how could you advice which method a farmer could use to accomplish his/her needs. And which method you will discourage a farmer to use and give him/her one major reason why you discourage the use of this methods. - a. Both plant and animals show the growth character but the way plant grows differ from animals and they also exhibit different types of growth curves. With the aid of one example of organism for each type of growth, explain the following types of growth.
i. Isomeric growth.
ii. Limited growth.
iii. Allometric growth.
iv. Localized growth.
v. Indeterminate growth.
b. The growth of perennials plant differ from the growth of annual plant, by using graphs describe the growth pattern of perennial plant. - a. i. Briefly explain the structure of micro bodies.
ii. Why liver cells contain more micro bodies than other organs in the cell?
b. Cell membrane has various parts which help it to perform their functions. Mention the structure which enable cell membrane to perform the following functions.
i. Act like a plug reducing ever further the escape or entry of polar molecules through the membrane.
ii. Selective transport of polar molecules and ions across the membrane.
iii. Involve in sticking the correct cell together in tissues.
iv. Recognition site for chemical signaling between cells. - The figure 1 below illustrates a vertical section through an angiosperm ovary at the time of fertilization.
a. i. Name the structure labelled A-H in the diagram above.
ii. List in correct order, the regions in the ovary through which pollen tube must pass and grow in order to reach embryo sac.
b. Following fertilization, which part(s) of the seed or fruit is formed from features labelled D, E, G and H.? - a. Study the information on the rate of an enzyme reaction at various PH then answer the question that follows:
| PH value | Time to collect gs (min) |
| 4.00 | 20 |
| 5.00 | 12 |
| 6.00 | 10 |
| 7.00 | 13 |
| 8.00 | 17 |
- Sketch the information above in a graph with time as Y axis.
ii. From your graph, what is the maximum PH for the reaction?
iii. Basing on pattern of your graph, make interpretation of your graph. - The diagram below shows a metabolic pathway in which substrate A converted with the aid of enzymes to the end product D.
Enzyme 1 → Enzyme 2 → Enzyme 3
A → B → C → D
Giving an explanation for your answer, suggest what would happen to the rate of production of end product D, if;
i. The concentration of substrate A were reduced.
ii. The concentration of Enzyme 1 were increased but the concentration of other enzymes remained constant.
iii. Suggest how molecule D could act as end product inhibitor.
iv. Name the type of control mechanism which regulate the production of end product D.
- a. i. Classify receptor into five categories on the basis of the stimuli they respond to.
ii. Name the stimulus in each case.
b. Tabulate four differences between rods and cones. - a. i. Describe the steps involved in conversion of phosphoglyceric acid into sugar during reduction phase of C3 cycle.
ii. Naming C3 cycle as dark reaction is sometimes misleading. Substantiate.
b. Explain what will happen to intestinal digestion if liver could not produce bile juice. - a. What do you understand by a dichotomous identification key?
b. From your knowledge of classification, construct a simple numbered dichotomous key which could be used to identify the classes of phylum chordate, Mammalia, Aves Reptilia, Amphibian, Chondrichthyes, and Osteichthyes. Use the following features; hair, skeleton type, scales, fins and feathers. - Divers faces some changes in oxygen uptake while they are in water, but they can adapt to live in water as terrestrial and mountain climbers by developing the unique features. State the adaptation of divers to oxygen uptake (5 points)
- Give the roles of each of the following hormones in human male and female reproduction.
| Hormone | Role in human male | Role in human female |
| FSH | ||
| LH |
- i. The calyx of a certain plant has 22 chromosomes, state number of chromosomes present in its endosperm, polar nuclei, egg nucleus, pollen tube nucleus, embryo sac and mega sporangium.
ii. Briefly explain four changes in flower after fertilization.
- a. Using examples explain two advantages of closed double circulatory system.
b. How the following cells/tissue are adapted to their functions?
i. Xylem.
ii. Root hairs. - Explain:
a. Why the amount of lactic acid in the blood increases at the end of race although Oxygen consumption rises during the race.
b. Why is athlete’s oxygen consumption still higher than normal sometimes after the race.
c. For every molecule of glucose, 38ATP molecules are produced during aerobic respiration. But 2ATP molecules are produced during anaerobic respiration. Why?
d. Why is it advantageous to respire glycogen rather than glucose during strenuous exercise?
e. What are the advantages of oxidizing of fat as a respiratory substrate? - a. Give reasons for each of the following statements.
i. Carbohydrates are major respiratory substrate?
ii. Carbohydrates produces less energy than lipids?
iii. Why the percentage of oxygen in the alveolus less than that in inspired air?
iv. Lactic acid stored in blood continue to rise after exercise when anaerobic respiration ceased?
- Use oxygen-haemoglobin dissociation curve, explain how the following factors influencing haemoglobin affinity to oxygen.
i. Temperature and blood PH
ii. Body size
iii. Myoglobin
- a. i. Give two reasons why there is suddenly influx of Sodium ion Na+ into axon following an increase of Sodium ion permeability of the axon membrane
ii. If the permeability of the axon membrane to Sodium Na+ and Potassium (K+) increases simultaneously what effects would this have on action potential? (Give two reasons)
b. Explain the application of natural and synthetic phytohormones in crop production and weed control. (4 points).
…continued from the PDF document.
- a. The mammalian digestive system has a number of digestive glands located various parts of its walls. Complete the table below by indicating the names of the digestive gland located in the walls of the stomach, their secretions, composition of their secretion and roles in the digestion process.
| Name of part of digestive system | Name of gland | Secretion | Composition of secretion | Roles of each content of secretion |
| (i) Stomach |
- Explain any five (5) factors affecting the rate of photosynthesis.
- a. How is the xylem tissue adapted to its functions? Give five (5) points.
b. By using Munch’s Mass Flow Hypothesis, describe how organic solutes are translocated through the phloem. - a. Draw the diagram of a pollen grain.
b. Explain the adaption of sperms towards fertilization.
c. Identify the types of embryonic membranes and state one function of each. - a. i. What is glycolysis?
ii. Explain the importance of fermentation process in daily life.
b. i. Briefly explain the meaning of Basal Metabolic Rate (BMR).
ii. Explain the fate of pyruvic acid under anaerobic respiration. - a. In a practical session, Mr Njige instructed students as follows:
i. Slice onion longitudinally into small parts using knife/scalpel.
ii. Remove the thin transparent layer and put it on a watch glass containing water.
iii. Mount specimen on microscope slide and add a drop of iodine solution.
iv. Place a cover slip and observe specimen under electronic microscope.
- Why you put specimen in water during step II?
c. What was the role of iodine in this experiment?
d. Draw a well-labelled diagram of your observation.
- a. i. Briefly explain why the surgical removal of stomach in humans is not necessarily fatal.
ii. Bile does not contain enzymes, yet it is important for digestion. Explain.
b. In five (5) points differentiate two (2) types of photophosphorylation. - a. In four (4) points explain why mammalian foetus cannot survive if placenta is severely damaged.
b. With the aid of a diagram describe the life cycle of housefly. - a. Cell wall have been proved to be a vital part of a plant cell. However, animal cells lacks cell wall. Explain how an animal cell can survive without a cell wall.
b. In tabular form contrast prokaryotic from eukaryotic cells basing on the following features; nucleus, reproduction, ribosomes DNA and cell division.
c. With examples describe the classification of protein according to their functions. - a. State the role(s) played by each of the following in process of respiration:
i. NADH
ii. Complex III
iii. Complex V
iv. Co-enzyme Q
v. Cytochrome C
- Equal amount of two substrates: A(C51H98O6) and B(C7H14O7) were completely aerobically oxidized in the cell.
i. Calculate the Respiratory Quotient (RQ) of substrates A and B and give deductions from the value obtained.
ii. Which substrate will be the cell’s first choice for oxidation? Give one reason.
iii. Which substrate will produce more energy after full oxidation? Give one reason.
- a. Describe the events which comprises the mechanism of fertilization in an adult female.
b. Nerve impulse has its own features that enable it to be transmitted along the neurone for effective coordination. In five (5) points give characteristics of a nerve impulse that makes it suitable to be transmitted along the neurone.
- Complete the table below:
| Endocrine gland | Hormone(s) produced | Functions |
| (i) Adrenal medulla | ||
| (ii) Adrenal cortex | ||
| (iii) Pancreas | ||
| (iv) Pineal gland | ||
| (v) Testes |
- a. In ecological survey, one community was found to be empty with no vegetation cover. As the time goes, some vegetation were found to emerge from that community.
i. Give the process that occurred in 5(a) above.
ii. Briefly explain what happened to the community in 5(a) above.
- Explain why a small proportion of energy taken up by each level of food chain is transferred to the next step.
- 50 animals are caught and tagged and released later 220 animals are caught and it is noted that 35 of their animals are tagged. What will be the total population estimate?
- Organic evolution is a real and actual natural process though some scholars are still debating on it. Justify this statement by using any evidence from paleontology, comparative morphology and anatomy.
- Mr Njige is a geneticist who was verifying Mendel’s first and second laws of inheritance crossed 45 homozygous red flowered plants with 45 homozygous white flowered plants. The results of F1 offspring were 530 plants all with pink flowers. He then selfed the 530 pink flowered plants and the seeds obtained were planted. The F2 plants with the following phenotypes were obtained:
- 1295 red flowered plants
- 2570 pink flowered plants
- 1290 white flowered plants
- Illustrate using symbols the crosses made and the results obtained in the above experiment.
ii. What is the name given to the mode of inheritance exhibited by the flower colours in the above described experiments?
iii. How do the above observations differ from the Mendel’s results that led him to formulate first and second laws of inheritance?
iv. Describe the genetical test you would carry out to prove whether or not the pink flower colour in the above experiment is a true deviation from Mendel’s principle of inheritance.
- a. “Omnis cellular e cellular”. Every cell resulted from pre-existed cell. Justify this statement.
b. i. Explain why cellular differentiation is generally referred to as a cellular division of labour?
ii. Fluid mosaic model has become the most acceptable theory to describe the structure of the plasma membrane. Justify the validity of this statement using three (3) points.
iii. In what ways are lysosomes and peroxisomes different? - a. What are the main theoretical models that try to explain the formation of the enzyme-substrate complex?
b. How is temperature related with medical transplants and enzymatic reactions? - a. Sexual reproduction in animals exhibit various complications, such as blue baby, ectopic pregnancy and still birth. Elaborate on the named complications.
b. Explain the mechanism of foetal blood circulation. Diagram is not necessary. - a. Discuss the mechanism by which the male gametes are formed in male gonads. Illustrate your answer.
b. Why menstrual cycle stops soon after successful fertilization? (2 marks)
c. i. What is parturition?
ii. Which hormones are involved in induction of parturition? - a. Why is the Krebs cycle also called the final common pathway of the breaking down of organic compounds?
b. i. What is glycolysis?
ii. Step by step explain how glycolysis occurs in cytoplasm. - a. Draw the diagram of a pollen grain.
b. Explain four features which prevent self-fertilization in advanced plants.
c. Identify the types of embryonic membranes and state one function of each.
d. Meiosis is a reduction process, whereas mitosis is an equational process. Explain. - a. Analyze the changes which occur in the flower after fertilization.
b. Explain the functions of each of the following hormones.
i. Follicle stimulating hormone (FSH).
ii. Oestrogen hormone.
iii. Luteinizing hormone (LH).
- a. Discuss the four (4) levels of structure of protein and relate each levels to particular bonding patterns.
b. i. State two (2) effects of temperature on enzyme catalyzed reactions.
ii. Describe how end-product inhibition works. - a. i. Imagine that an individual is severely damaged from his or her kidney. What problems is likely to suffer?
ii. Table 1 summarizes the relationship between excretory product and the habitat of the respective animal group. Complete the table.
| Animal | Excretory product | Habitat |
| Protoctist | ||
| Terrestrial insect | ||
| Fresh water bony fish | ||
| Marine bony fish | ||
| Bird | ||
| Mammal |
- a. Enumerate three symptoms of each of the following disorders of urinary system in human being.
i. Bladder infection
ii. Kidney stone
iii. Kidney gout
iv. Kidney failure - a. i. Write the base sequence of mRNA formed from a DNA strand with the following sequence:
ATGTTCGAGTACCATGTAACG
- What are the main features of genetic code? Give five (5) points.
- A homozygous purple flower-short stemmed plant was crossed with a homozygous red flower-long stemmed plant and F1 phenotype had purple flower and short stems. When F1 generation was test crossed with double homozygous recessive plant the following progeny were produced:
- 52 purple flower-short stem
- 47 purple flower-long stem
- 49 red flower-short stem
- 45 red flower-long stem
Explain these results fully.
- a. i. Although process of mitosis in plant and animals have the same purpose explain three differences exist between them.
ii. Interphase considered as a non-dividing phase, why it is important phase in the cell division?
- With aid of diagram describe theories of apical organization.
- Explain the three (3) factors that affect seed viability.
- a. What are the limitation of different ecological pyramids which shows the feeding relationship of the biotic components of the ecosystem?
b. i. Explain why small proportion of energy taken up by each level of food chain is transferred to the next level. Give four (4) points.
ii. Population of any place is dynamic and not static. Explain four factors that cause this phenomenon in any area. - a. State location and role of the following in the alimentary canal.
i. Oxyntic cells.
ii. Goblet cell.
iii. Crypts of Lieberkuhn.
- State the conditions in which light and temperature might be limiting factors in photosynthesis.
- a. Briefly discuss the mechanisms by which genetic variation is produced by the process of meiosis.
b. Explain why most bryophytes colonize moist habitats. - With aid of a diagram, describe the mechanism of transport of manufactured food in phloem based on Munch’s mass flow hypothesis.
- Menstruation is a hormonal controlled physiological process that occur in female and is under control of the following hormones:
Follicle stimulating hormone, Oestrogen, Luteinizing hormone and progesterone.
- Draw a graphical representation and indicate the hormonal changes of blood levels in the pituitary and ovary hormone that take place from 1st up to 28th day if fertilization does not occur.
- Describe the changes of the levels of hormones as indicated in the graph constructed above.
- Using words joined by arrows, describe the process of glycolysis.
- a. The volume of air exchanged in the alveolus is in fact less than that of pulmonary ventilation. Suggest why this is the case.
b. Briefly explain why the metabolic rate of rat is higher than that of elephant.
c. Explain the factors that govern efficiency of gaseous exchange at the respiratory surface. - a. Explain the role of synthetic phytohormones for the development of industrialised Tanzania.
b. Briefly explain the following terms as used in organic evolution.
i. Adaptive radiation
ii. Micro-evolution
iii. Selection pressure
iv. Convergent evolution
- Explain the six (6) types of fossils and their formation.
- a. Robert Hooke (1665), Theodor Schwann and Mathias Schleiden, Rudolf Virchow and Anthony Leeuwenhoek (1674) are the scientists that until today are being remembered in the study of cytology. In one point for each scientist justify the validity of this statement.
- Mature erythrocytes in most mammals do not possess some important organelles which contradict it with cell theory. Name two organelles which mature erythrocytes do not possess and give reasons to why they do not possess such structures.
- Give one reason that support each of the following biological facts as used in cytology:
i. Without nucleus there is no cellular activities that will take place in the cell.
ii. Lysosomes are sometimes known as suicide bags.
- a. Mr. Njige is the Medical Doctor at Muhimbili National Hospital. He conducted a post mortem diagnostic on 26 years old woman and noticed that she had ovaries which were of unequal size. The ovaries were analyzed and results were shown below with the following contents:
| Large ovary | Small ovary |
| 18,005 follicles | 26,000 follicles |
| 8 corpora lutea | 10 corpora lutea |
| 28 corpora albicans | 100 corpora albicans |
Most of the follicles were small but 246 were over 100 µm in diameter. Ten (10) follicles contained two oocytes each and 4% of the oocyte contained nuclei each. Assuming that each follicle produces a corpus luteum:
- At which stage did the woman start ovulation?
ii. Estimate the time in years that ovulation would have continued in that old woman.
iii. How many potential sets of twins could this woman produce?
iv. Name the process that account for the presence of two nuclei in some of the oocytes. - You have given the equation of the certain respiratory substrate as:
2C₅₁H₉₈O₆ + 145O₂ → 102CO₂ + 98H₂O
- What is R.Q of the given food substance?
ii. Identify the type of food substrate according to the equation with reason.
iii. Identify the type of metabolism taking place with the reason. - i. What would happen if the first enzyme in glycolysis is irreversibly inhibited by toxic substance?
ii. Briefly explain why NADH gives more ATP than FADH in electron transport.
- a. i. Name three theories of origin of life.
ii. Explain the origin of life based on the theories named in 1(a)(i).
- Explain the mechanism of organic evolution according to Lamarck theory and state strengths and weakness of the theory.
- a. Explain the Lamarck’s Theory of Evolution.
b. Explain why almost all modern biologists reject the Lamarck’s Theory of Evolution. - a. Enumerate six essential features of natural selection as put forward by Charles Darwin.
b. Describe how geographical, reproductive and genetic isolations bring about speciation. - Describe how vestigial organs, chemical constituents and physiological processes support evolution among groups of organisms.
- Giving examples, explain how each of the following evidences supports organic evolution:
a. Palaeontology
b. Comparative morphology and anatomy
c. Comparative biochemistry
d. Comparative embryology - a. Briefly describe four theories of origin of life.
b. Outline the strengths and weaknesses of each of the theory described. - a. Explain six essential features of natural selection.
b. Describe how geographical, reproductive and genetic isolations bring about speciation. - a. During cancer treatment, a patient is exposed to a powerful radiation therapy that accidentally damages the nuclear envelope of rapidly dividing cells. Predict five (5) effects of this damage on metabolism and division of the cell.
- Some cellular organelles may have different names and functions when present in different type of cells. Consider the organelles found in the following cells to prove the statement above.
• Plasmodesmata in xylem tracheids
• Ribosomes in the cell body of a nerve cell
• Lysosome in mature spermatozoa
• Lysosome in secondary oocyte
• Plastids in insect pollinated flowers
- During a practical lesson, students tested different food samples using Benedict’s solution, Biuret test, and iodine solution. One sample turned brick-red with Benedict’s solution, purple with Biuret test but showed no colour change with iodine solution.
- Identify the biochemical compounds present in the food sample based on the test result.
- i. In two points for each, explain the importance of biochemical compounds identified in 2(a) above.
ii. Name the enzyme responsible for hydrolysis of each compound and location in the gut where the hydrolysis occurs.
66.a. An African bush elephant belongs to order Proboscidae and family Elephantidae. Its scientific name is Loxodonta africana. Make a table indicating the hierarchy classification of this animal.
- Form six students at Kiembeni secondary were provided with a variety of specimens. Some students grouped the specimens based on habitats while others used modern advanced biological criteria.
i. Outline five criteria incorporated by the other students.
ii. Why do you think habitat alone is not a reliable basis for classifying organisms?
- a. By using two points for each, suggest natural circumstances or habitat in which light intensity and temperature might be limiting factors in photosynthesis. Give your response as in the table below:
| Limiting factors | Natural circumstance or habitat |
| Light intensity | (i) |
| (ii) | |
| Temperature | (i) |
| (ii) |
- Explain how glandular tissues are adapted to the function they perform in the alimentary canal. (Give six points)
- a. Calcium ions enter neurone through pre-synaptic membrane when action potential arise.
i. Explain how these ions enter the neurone.
ii. Without diagrams, describe the events which follow the entry of these ions until depolarization of post synaptic membrane.
- Draw a well labelled diagram showing a transverse section of cochlea.
- a. A student compares muscle cells during intense exercise, yeast cells in a sealed container and plant tissue growing in water logged soil where oxygen is limited. Apply the knowledge you obtained from biology to explain the fate of pyruvic acid in these cells under given conditions. Include chemical equations to your explanation.
- Give the role(s) of the following structures in the human respiratory system.
i. Cartilage in trachea
ii. Ciliated epithelium in bronchi
iii. Goblet cells in bronchioles
iv. Collagen fibre in alveoli
- While reviewing some biological literature, form six students at Chombezi secondary school discovered that the process of gamete formation in humans involves four phases. However, most of the books hold that the process is accomplished in only three phases. With the aid of diagram, refer to oogenesis to prove correct these students.
- a. Like animals, plants need the movement of two atmospheric gases in and out of their body cells. With the help of a diagram describe the mechanism by which plants achieve this process.
- Clearly explain how each of the following factors affect the rate of respiration in mammals.
• Oxygen concentration
• Temperature
• Levels of physical activities
• Types of food substrate
• Availability of energy (ATP)
- a. During demonstration of absorption of water and mineral salts in the root, a biology instructor said that the transported materials might take different routes to reach the xylem before taken to the upper parts of a plant. With the aid of a diagram explain three routes described by the instructor.
- Two organisms are placed in a controlled environment with oxygen sensors. Oxygen levels in the tissue of one organism rise slowly while in the other rise quickly. Explain three differences in their circulatory systems that cause this observation.
- a. Briefly describe how the following conditions favour the movement of pollen grains between two angiosperms located in different areas.
i. Protandry and protogyny
ii. Dioecious
iii. Self incompatibility (self-sterility)
- In reference to nature of the gamete, type of fertilization and fertilization medium, prove the statement that bryophytes exhibit a lot of reproductive features in common with amphibians.
- a. With the aid of a diagram, describe structure of cell wall of the plant cell.
b. i. Name the structure of lignin and suberin in cell wall.
ii. Name the structure which joins the neighboring cells. - a. Give reason why the following cells are equipped with large number of lysosomes:
i. Salivary gland cells
ii. Cells lining digestive system
iii. Leucocyte
iv. Cells lining uterus
- Briefly explain the three common ways through which enzymatic activities are regulated.
- a. If a plant is placed in a CO₂ free atmosphere in a bright light, will light dependent reaction continue to generate ATP and NADPH indefinitely?
- Explain why electron carriers in non-cyclic photophosphorylation are arranged in different energy levels.
- Explain the importance of three proteins associated with thylakoid membrane of the grana.
- a. Describe the four principles of systematics in natural system of classification.
- Explain five disadvantages of naming organisms using locally based names over scientific names.
- a. Describe the interaction between hormone and nervous system.
- Comment on the hormone that is mostly likely to produce the desired effect on each of the following:
i. A biology teacher wants to demonstrate that a dwarf variety of maize plant can be made to grow to normal size.
ii. A farmer wants to ripen his orange rapidly so as to meet the demand of new market.
iii. A farmer wants to initiate and stimulate root development in his cutting before planting them.
iv. A farmer wants to prolong shelf life of his cabbages to prevent rooting.
- Most farmers in Tanzania use seeds as a propagation technique for producing most cash and food crops. What do you think are the advantages and disadvantages of reproducing by using such technique compared to others? Give five points in each case.
- a. Describe the structural components of phloem tissues.
- i. Explain characteristic features of single blood circulatory system.
ii. How does circulatory system of Arthropods differ from that of Human being? Give five points.
- a. Explain the extra embryonic membrane and give its four roles.
b. Illustrate stages of spermatogenesis. - a. Explain how electron transport chain occurs in aerobic respiration.
b. Describe three factors which cause variation of BMR of an individual. - a. Apart from removing waste products generated by cells throughout the body, the urinary system is also involved in homeostatic control of different body conditions. In five (5) points support the statement above.
- By using three (3) points in each, show how renal corpuscle and distal convoluted tubules are adapted to their roles.
- a. Using examples, explain the meaning, causes and biological and environmental consequences of human population explosion.
- In four (4) points support the statement that the living component of ecosystem interact in different ways to achieve their everyday life needs.
- With the aid of diagram describe the life cycle of plasmodium by considering the following three main stages:
i. Pre-erythrocytic stage
ii. Erythrocytic stage
iii. Sporogenic stage - a. During protein synthesis, a student notices that different sequences of three nitrogenous bases specify different amino acids. Using this observation, explain four (4) features of these specific sequences.
- A cross between pure red flowers of sweet pea and pure white flowers of sweet pea produced red flower offspring in F1. On selfing the F1 plants, F2 had the phenotypes as shown below:
| Phenotype | Number |
| Red flower | 418 |
| Purple flower | 106 |
| White flower | 36 |
Carry out genetic crosses to show the phenotypes and genotypes of F1 and F2.
- a. A blacksmith develops very strong arms due to daily heavy work, but his children are born with normal arm muscles. Using this example, explain why Lamarck’s theory is rejected by modern biologists. (Give four (4) reasons)
- Explain any four factors (mechanisms) that would cause a natural arising of new species from the main population.
- a. You have been assigned to prepare a display board demonstrating how plant cells increase in number. With the aid of diagrams respond by showing clearly the events involved from their preparation to separation stages.
- What are the significance of the process you have demonstrated above? (Give four (4) points).
- a. Viruses are regarded as non-living entities. Justify this statement by giving five points.
- Account for significance of members of the animal kingdom in the development of industries such as agriculture, medicine, and manufacturing industries.
- a. Examine four factors that determine the type of nitrogenous waste eliminated in mammals.
- Terrestrial animals are liable to water loss by evaporation. Explain how these animals overcome this problem.
- a. The figure below shows growth pattern in humans, the head grows rapidly during early childhood while other body parts grow faster at later stages.
i. Identify this type of growth and name the organs represented by the part of curve labelled Q and R.
ii. Explain why there is a rapid growth in organs Q and R during a certain stage of child growth.
iii. Explain the growth pattern as illustrated in the figure above.
iv. State one biological importance of the growth identified in (i) above.
- Explain the factors that influence seed germination.
- a. Justify how genetic code in living things is said to be:
i. Punctuated
ii. Universal
iii. Triplet
iv. Non-overlapping
v. Degenerate
- i. Why is it not possible to use some homozygous dominant organisms (such as TT) in a test cross experiment to determine the genotype of organism showing dominant phenotype? Illustrate your answer fully using appropriate genetic symbols.
- Why haemophiliac individuals are fewer than colour blind people in a population in spite of the fact that both are sex linked traits?
iii. In human, colour blindness allele (c) is recessive to normal vision allele (C). Two parents with normal vision have colour-blind son. What is the probability that their next child will be a colour blind daughter?
- a. Explain with examples, why analogous and homologous structure show antagonistic way of evolution of organisms.
- Describe how different types of fossils are formed.
- a. Explain the life cycle of Plasmodium.
- Fungi play important roles in human life and natural ecosystems. With example explain their advantages with reference to the following aspects:
i. Soil fertility improvement
ii. Antibiotic production
iii. Agriculture and plant growth
iv. Waste decomposition
v. Symbiotic relationships
- In a breed of poultry, feather colour is controlled by two genes where gene C produces black pigment while its recessive form produces brown pigments and gene I acts as a dominant inhibitor; the presence of allele I prevents pigment expression and results in white feathers regardless of the C gene.
- Work out the phenotypic ratio of the F2 offspring.
- State how epistasis differ from Mendelian inheritance.
- a. A river changes its course and separates a population of lizards into two isolated groups. Over time, the two groups develop different physical features and mating behaviors.
i. Describe the type of speciation involved.
ii. Describe other types of speciation which can occurs within living organisms.
- Briefly explain three observations and two deductions of Charles Darwin on natural selection.








